An Alternative Antibiotic for the Selection of Resistant Pro- and Eukaryotic Cells
Active substance: Nourseothricin (Streptothricins F, E and D)
Composition: 1 standard bag contains: 1000 mg of clonNAT Chemical name:
2-[4-O-Carbamoyl-2-deoxy-2-(3,6-diaminohexan-amido)- ß-D-gulopyranosylamino]-3,3a,5,6,7,7a-hexahydro-5-hydroxy- 4H-imidazo[4,5-c]pyridin-4-one dihydrogensulphate (example streptothricin F)
Characterization: In 1993 nourseothricin (trade name: clonNAT) [CAS 96736-11-7]was introduced as a selection agent for molecular genetic research work. The selection system clonNAT + plasmid pINS1 (later pHN15 and pYL16, some sequences removed) was developed by H. Kruegel et al. [Gene 127 (1993) 127-131; phone: +49 3641 65 66 84, Hans.Kruegel@hki-jena.de] at the Hans-Knoell-Institute for Natural Products Research in Jena. clonNAT is the dihydrogensulphate of the weakly basic antibiotic nourseothricin, consisting of the components streptothricin F, E and D. These antibiotics are produced in cultures of a strain of Streptomyces noursei.
Stability, Toxicity, Activity:
Characteristic for the preparation is its high stability (10 years at 4 °C, 2 years at 20 °C, keep small amounts under Argon protection gas, protect from oxygen, light, heat) of the crystalline salts, very good water solubility, relatively low oral toxicity (LD50: 1185 mg/kg, rats, no absorption in the digestive system) and a wide range of antibiotic effects against gram-positive and gram-negative bacteria, also against mycobacteria, mycoplasms, protista, certain DNA and RNA viruses and plants. On the other hand, inhibition of the growth processes of yeasts and fungi are weaker. Nevertheless clonNAT is exceptionally suitable for the selection of recombinant yeast strains (cf. A. Goldstein 1999).
Mode of Action:
The mechanism of action of nourseothricin is comparable with that of other aminoglycoside antibiotics: Specific partial steps of the protein synthesis are inhibited by the antibiotic. Development of resistance is based on monoacetylation of ß-amino groups of the ß-lysyl moiety of the streptothricin molecules. clonNAT is not used for therapeutic purposes, and there is no cross resistance with therapeutics used in medicine. It is therefore very suitable in selection systems as a selective agent together with resistance genes nat, sat, stat, since resistance dominants, which could cause nosocomial infections with medically relevant organisms, are not selected through its use.
Application:
Filling up of 1000 mg of clonNAT (the product is not sterilized and not free of pyrogens!) with 5 ml distilled water gives a stock solution with 200 mg clonNAT/ml. This stock solution can be stored up to 4 weeks at +4 °C without any detectable loss in activity. For storage of 6 months the solutions must be frozen at –20 °C or deeper. Sterile filtration is necessary before use! Solutions to be used for molecular genetic work are prepared by further dilution with distilled water. Recommended suitable clonNAT concentrations (m. i. c. values) in the nutrient medium are as follows:
Escherichia coli 50 micro g/ml
Saccharomyces cerevisiae 100 micro g/ml
Ustilago maydis 75 micro g/ml
Leishmania sp. >100 micro g/ml
Cryptococcus neoformans 100 micro g/ml
Arabidopsis thaliana 100 micro g/ml
Safety data:
According to available data clonNAT is harmful if swallowed, Xn, as defined in the Chemicals Law (ChemG and GefstoffV). See the Material Safety Data Sheet of product # 5.0000, WERNER BioAgents). R 22-36/37/38, S 26-36. If there is contact with skin or eyes, wash off with water. Disposal and decomposition: An addition of sodium hydroxide solution (pH >12) inactivates clonNAT within 3 hours (the molecule is degraded chemically). In acid solutions clonNAT is much more stable than in alkaline media.
Description of the Plasmid pYL16
For subcloning into various vectors the nourseothricin resistance gene conferring resistance to clonNat this plasmid is offered. pYL16 contains a BamHI-PstI PCR fragment from nat1 (gi|300195|gb|S60706.1| S60706[300195] X73149 , the S. noursei gene for nourseothricin acetyltransferase gi|1222691|emb|X73149.1|SNNAT1[1222691]) cloned into pUC118 under control of the vegp promoter from B. subtilis (LeGrice and Sonenshine, J.Mol.Biol. (1982) 162, 551-564) (J01552) as an EcoRI-BamHI fragment, active in E. coli, B. subtilis and Streptomyces. Restriction enzyme sites are bold and the start and stop codons of the nat1 are underlined. As an EcoRI-PstI fragment many bacterial hosts can be used utilizing the veg promoter, the BamHI-PstI fragment as a promoter-less gene requires the combination with a host specific promoter.
EcoRI
GAATTCTCATGTTTGACAGCTTATCATCGAATTATAGGAATAGAGCAAACAA
GCAAAGGAAATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGAT
ATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGTAGT
GAGGTGGATGCAATGGCGAAGACGTTGTCCGATATTAAAAGATCGCTTGATG
GGAATTTAGGTAAAAGGCTGACGTTAAAAGCAAACGGTGGCC
bamHi
GGATCCATATGACCACTCTTGACGACACGGCTTACCGGTACCGCACCAGT
GTCCCGG GGGACGCCGAGGCCATCGAGGCACTGGATGGGTCCTTCACC
ACCGACACCGTCTTCCGCGTCACCGCCACCGGGGACGGCTTCACCCTGC
GGGAGGTGCCGGTGGACCCGCCCCTGACCAAGGTGTTCCCCGACGACGA
ATCGGACGACGAATCGGACGCCGGGGAGGACGGCGACCCGGACTCCCGG
ACGTTCGTCGCGTACGGGGACGACGGCGACCTGGCGGGCTTCGTGGTCGT
CTCGTACTCCGGCTGGAACCGCCGGCTGACCGTCGAGGACATCGAGGTCG
CCCCGGAGCACCGGGGGCACGGGGTCGGGCGCGCGTTGATGGGGCTCGC
GACGGAGTTCGCCCGCGAGCGGGGCGCCGGGCACCTCTGGCTGGAGGTCA
CCAACGTCAACGCACCGGCGATCCACGCGTACCGGCGGATGGGGTTCACCC
TCTGCGGCCTGGACACCGCCCTGTACGACGGCACCGCCTCGGACGGCGAGC
AGGCGCTCTACATGAGCATGCCCTGCCCCTGAGCGGCCTGCAG
