Products
Information
clonNAT + Plasmid pYL16
Material safety data sheet


clonNAT + Plasmid pYL16

 

<CLASS=STD12 align="left">An Alternative Antibiotic for the Selection of Resistant Pro- and Eukaryotic Cells
Active substance: Nourseothricin (Streptothricins F, E and D)

Composition: 1 standard bag contains: 1000 mg of clonNAT Chemical name:
2-[4-O-Carbamoyl-2-deoxy-2-(3,6-diaminohexan-amido)- ß-D-gulopyranosylamino]-3,3a,5,6,7,7a-hexahydro-5-hydroxy- 4H-imidazo[4,5-c]pyridin-4-one dihydrogensulphate (example streptothricin F)

Characterization: In 1993, nourseothricin (trade name: clonNAT) [CAS 96736-11-7]was introduced as a selection agent for molecular genetic research work. The selection system clonNAT + plasmid pINS1 (later pHN15 and pYL16, some sequences removed) was developed by H. Kruegel et al. [Gene 127 (1993) 127-131] at the Leibniz Institute for Natural Products Research and Infection Biology - HKI, Jena. clonNAT is the dihydrogensulphate of the weakly basic antibiotic nourseothricin, consisting of the components streptothricin F, E and D. These antibiotics are produced in cultures of a strain of Streptomyces noursei.

Stability, Toxicity, Activity:
Characteristic is the high stability of its crystalline salts (2 years at 4 °C, keep small amounts under protection gas, i.e. nitrogen, argon, protect from oxygen, light, heat), very good water solubility, relatively low oral toxicity (LD50: 1185 mg/kg in rats, no absorption in the digestive system) and a wide range of antibiotic effects against gram-positive and gram-negative bacteria, also against mycobacteria, mycoplasms, protista, certain DNA and RNA viruses and plants. On the other hand, growth inhibition in yeast and fungi are weaker. Nevertheless, clonNAT is exceptionally suitable for the selection of recombinant yeast strains
(A. Goldstein 1999).

Mode of Action:
The mechanism of action of nourseothricin is comparable with that of other aminoglycoside antibiotics: specific partial steps of the protein synthesis are inhibited by the antibiotic. Development of resistance is based on monoacetylation of ß-amino groups of the ß-lysyl moiety of streptothricin molecules. clonNAT is not used for therapeutic purposes and there is no cross resistance with therapeutics used in medicine. Therefore, it is very suitable in selection systems as a selective agent together with resistance genes nat, sat, stat, since resistance dominants, which could cause nosocomial infections with medically relevant organisms, are not selected through its use.

Application:
Dissolve 1000 mg of clonNAT (the product is not sterilized and not free of pyrogens!) in a total volume of 5 ml distilled water thus resulting in a stock solution of 200 mg clonNAT/ml. This stock solution can be stored up to 4 weeks at +4 °C without any detectable loss of activity. For a storage up to 6 months, the solution has to be frozen at least at –20 °C. Sterile filtration is necessary before use! Dilutions of stock solutions should be prepared using destilled water. Following concentrations (m. i. c. values) in the nutrient medium are recommended:

Escherichia coli 50 µg/ml
Saccharomyces cerevisiae 100 µg/ml
Ustilago maydis 75 µg/ml
Leishmania sp. >100 µg/ml
Cryptococcus neoformans 100 µg/ml
Arabidopsis thaliana 100 µg/ml

Safety data:
According to available data clonNAT is harmful if swallowed [GHS 07, irritating, as defined  ChemG and Gefstoff V. See Material Safety Data Sheet of product # 5.0, WERNER BioAgents GmbH, R 22-36/37/38, S 26-36]. In case of skin or eyes contact, wash off with water. Disposal and decomposition: addition of sodium hydroxide solution (pH>12) inactivates clonNAT within 3 hours (the molecule is degraded). In acid solution, clonNAT is much more stable than in alkaline media.

Description of the Plasmid pYL16
For subcloning into various vectors, a plasmid containing a resistance gene against clonNAT is offered. pYL16 contains a BamHI-PstI PCR fragment from nat1(k) (gi|300195|gb|S60706.1| S60706[300195] X73149 , the S. noursei gene for nourseothricin acetyltransferase gi|1222691|emb|X73149.1|SNNAT1[1222691]) cloned into pUC118 under control of the vegp promoter from B. subtilis (LeGrice and Sonenshine, J.Mol.Biol. (1982) 162, 551-564) (J01552) as an EcoRI-BamHI fragment, active in E. coli, B. subtilis and Streptomyces. Restriction enzyme sites are bold and the start and stop codons of the nat1 are underlined. As an EcoRI-PstI fragment many bacterial hosts can be used utilizing the veg promoter, the BamHI-PstI fragment as a promoter-less gene requires the combination with a host specific promoter.

EcoRI
GAATTCTCATGTTTGACAGCTTATCATCGAATTATAGGAATAGAGCAAACAA
GCAAAGGAAATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGAT
ATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGTAGT
GAGGTGGATGCAATGGCGAAGACGTTGTCCGATATTAAAAGATCGCTTGATG
GGAATTTAGGTAAAAGGCTGACGTTAAAAGCAAACGGTGGCC

bamHi
GGATCCATATGACCACTCTTGACGACACGGCTTACCGGTACCGCACCAGT
GTCCCGG GGGACGCCGAGGCCATCGAGGCACTGGATGGGTCCTTCACC
ACCGACACCGTCTTCCGCGTCACCGCCACCGGGGACGGCTTCACCCTGC
GGGAGGTGCCGGTGGACCCGCCCCTGACCAAGGTGTTCCCCGACGACGA
ATCGGACGACGAATCGGACGCCGGGGAGGACGGCGACCCGGACTCCCGG
ACGTTCGTCGCGTACGGGGACGACGGCGACCTGGCGGGCTTCGTGGTCGT
CTCGTACTCCGGCTGGAACCGCCGGCTGACCGTCGAGGACATCGAGGTCG
CCCCGGAGCACCGGGGGCACGGGGTCGGGCGCGCGTTGATGGGGCTCGC
GACGGAGTTCGCCCGCGAGCGGGGCGCCGGGCACCTCTGGCTGGAGGTCA
CCAACGTCAACGCACCGGCGATCCACGCGTACCGGCGGATGGGGTTCACCC
TCTGCGGCCTGGACACCGCCCTGTACGACGGCACCGCCTCGGACGGCGAGC
AGGCGCTCTACATGAGCATGCCCTGCCCCTGAGCGGCCTGCAG

german print this page recommend page to a friend bookmarke page scroll to top


© blackfrog-design.de